AUGACGAGGCUUAGUCAGAUUUGU?

Question

use mRNA sequence to determine the amino acid sequence which would be generated

Answer 1

To start off, nucleotides pair in DNA adenine-thymine (A-T) and cytosine-guanine (C-G).  In mRNA though, thymine is replaced with uracil, changing the bondings to adenine-uracil (A-U) and cytosine-guanine (C-G).

Your sequence AUGACGAGGCUUAGUCAGAUUUGU is an mRNA sequence that has transcribed a cell's nuclear DNA during transcription.  The next step is for mRNA to exist the cell's nucleus and accomplish the following procedures; a process known as translation.  In the cytoplasm, this code will be read in 3s by tRNA (codons read in sequence as pairs of 3), which will carry an amino acid, form a polypeptide chain, and fall off to form a functional protein.

So to answer your question, the amino acid sequence copied from

AUGACGAGGCUUAGUCAGAUUUGU would be

TAC TGC TCC GAA TCA GTC TAA ACA.  Again, this is read by tRNA, which has the defaulted base pairings of A-T and C-G.

Hope this helps!!

Answer 2

from left to right split the RNA code into groups of three (3).

then interpret each codon (the groups of three) from left to right using a table for genetic coding and protein synthesis.

you can obtain a table from:

http://en.wikipedia.org/wiki/Genetic_cod...

Answer 3

Split the codon code into groups of 3 letters. Then using a table for mRNA to amino acids which can be found in most good textbooks, read off in the correct order to get the sequence