0 LIKES LikeUnLike
write the amino acid sequence of the protein that would be formed by translating this piece of mRNA.5' AUGGGCUUCCAGGACGGUCGG 3'using the sequnce above, describe what would happen to the protein product of this piece of mRNA in the following 2 scenarios:1. if a C were changed to a U:what type of mutation is this?2. If a C were deleted:What type of mutation is this?If a C were changed to a
Tags:
Report (0) (0) | earlier
Latest activity: earlier. This question has 3 answers.