What is the difference between gene library and synthetic DNA?

Question

What is the difference between gene library and synthetic DNA?

Answer 1

a library is just a collection of the dna. synthesized or otherwise.

synthetic dna is when you artificially create genes/dna sequence.

Answer 2

DNA synthesis technologies are often used to create gene libraries.

A gene library is a collection of different DNA molecules (lets say 10^3 to 10^10) whereas a synthetic gene is an individual molecule.

Gene synthesis is a tool when you are interested in producing a protein (e.g. insulin) and you already know the exact sequence you need. In this case gene synthesis can help you to improve expression by codon optimization.

DNA libraries are needed when you want to search for an insulin protein with improved characteristics (e.g. absorption kinetics). In this case you can screen a library of genes with insulin like sequences.

When you order a synthetic gene you should get a 100% correct construct. e.g.

#1 ATGCATGCATGCATGCATGCATGCATGCATGC

When you order a gene libary you get thousands of constructs

#1 ATGcccGCATGgggGCATGCATGCATGCATGC

#2 ATGCAcccATGCATGCATGgggGCATtttTGC

#3 ATGCATGCATGCATGCATGCAaaaATGCATGC

...