What would happen to the reading frame if three bases were inserted/deleted? Why?

Question

5’- ATGCTATCATTGACCTTGAGTTATTAA –3’

Answer 1

The reading frame would stay the same.  It takes 3 bases to make a codon and so a strand is translated 3 bases at a time (with the 3 bases of a coding section equalling one amino acid). In this way a peptide (protein) is built.  

If only 1 or 2 bases were inserted or removed, then there would be a frame shift and the entire protein would be wrong because different amino acids would be used.

So if 3 bases were inserted or removed,,then the reading frame will stay the same but an amino acid will be added or missing from the protein being built.  This may or may not not effect the function of the protein.   .  

Answer 2

The ribosome reads the DNA. It reads it 3 base pairs at a time. every 3 bases pairs makes an amino acid to construct a protein. Most proteins in the body are specific; meaning, a protein is usually made for a specific function.

If 3 bases were removed, that specific amino acid that that sequence of base pairs would have made would not be placed in the protein. Because a piece of the protein would be missing, it would alter the 3 dimensional shape of the protein which would directly affect the function. If the shape is not correct, the protein will not function properly and will become useless.

The same goes for inserted base pairs. If 3 base pairs are added, that is adding amino acids into the protein which would alter structure which would alter function.

Hope that helps!

Answer 3

Well which 3?

The sequence is translated in triplets, called codons:

If you delete the first 3 (the ATG start), translation will not occur from the RNA.

If you delete the last 3 (the TAA, one of 3 possible stops), translation will start but it will continue on (unless TAA are the last 3 bases on the strand) until another stop codon (TAA, TGA, or TAG) is encountered randomly.

You could delete 3 bases that affected 2 codons (the last part of one and the first part of the next).  This would likely result in at least one amino acid substitution, and probably 2.  Despite ANY change, it is still possible the protein will have some of (maybe even all of) it's original function.

Finally you could wind up just deleting 3 base pairs that only affect a single codon/triplet.  This results in a simple deletion of a single amino acid.  Once again this might affect the function of the peptide, or it might not.  It depends on both the protein and the extent and type of the occurring change